Targeting Cancer Stem Cells

 Targeting Cancer Stem Cells

From Takahashi and Yamanaka, Cell 2006,   Here, we demonstrate induction of pluripotent stem cells from mouse embryonic or adult fibroblasts by introducing four factors, Oct3/4, Sox2, c-Myc, and Klf4, under ES cell culture conditions. Unexpectedly, Nanog was dispensable. These cells, which we designated iPS (induced pluripotent stem) cells, exhibit the morphology and growth properties of ES cells and express ES cell marker genes. Subcutaneous transplantation of iPS cells into nude mice resulted in tumors containing a variety of tissues from all three germ layers”.”

 

Nude mice are deficient in the the immune system, so they allowed tumor formation by iPS cells and did not attack them. This observation indicated that when mature differentiated cells like fibroblasts which have specific functions, de-differentiate to immature pluripotent stem cells, they magnify the property of self-renewal and skew towards uncontrolled self-proliferation as opposed to differentiation. This indicates that tumor formation could be initiated by de-differentiated cells, where signaling pathway activity regulating self-renewal is amplified. Such cells called cancer stem cells could be exploited as targets for cancer therapy, as these signnaling pathways have basal activity in normal stem cells and are amplified in cancer stem cells. One such signaling pathway is the Wnt-beta catenin signaling pathway which promotes cancer stemness. For example Beta-catenin inhibitors are experimental cancer treatments currently being evaluated in early-phase clinical trials, focusing primarily on agents like tegavivint and FOG-001. There are currently no FDA-approved drugs that directly target the Wnt/β-catenin pathway due to challenges with toxicity and the complexity of cellular adhesion.atenin inhibitors are being tested in clinical trials. So alternate molecules in the cancer stem cell signaling pathways need to be validated as targets for cancer stem cell therapy.

Is a Synthetic Cell the same as Synthetic Life ?

 

From  a bioRxiv preprint , “Here we demonstrate a complete cell cycle for a synthetic cell undergoing selection, with genome replication, growth, resource acquisition via feeding, and genetically encoded division” from “A Chemically Defined Synthetic Cell Capable Of Growth And Replication”, Gaut et al., 2026.

Link: https://www.biorxiv.org/content/10.64898/2026.07.01.735724v1#:~:text=Here%20we%20demonstrate%20a%20complete,feeding%2C%20and%20genetically%20encoded%20division

The question I ask is a synthetic cell =synthetic life ? The answer is a resounding no. The hallmark of biological organisms, higher up the hierarchy of the tree of life is multicellularity followed by self-organization. Single cells survive in specific environments and are more primitive. So until the single cell shows potential for multicellularity and organization into colonies,clusters,tissues, it will be a bottleneck for synthesizing “living organisms” from scratch.

During the synthesis of  an artificial cell, it remains to be seen, that information coded in the molecular components or sub-structures sufficient for the derivation of a cell in a fluid environment; or does information encoded in the environment required ? A cell develops in a fluid environment as its cytoplasm is gel-like and not in a solid such as sand. Presumably, mobility of molecular components occur in a fluid. Maybe exchange of  information encoded in molecular components and the fluid environment via molecule-environment interactions lead to the emergence of a cell. The environment then becomes indispensable for higher-order organization. So under controlled laboratory conditions, the milieu for organization of cells into higher-order living structures, could be derived from natural environments such as  wetlands, marshes, hydrothermal vents as they will encode the environmental information.

Does Cancer Metastasis Occur via a Quorum-Sensing-Like Mechanism?

 

Does Cancer Metastasis Occur via a Quorum-Sensing-Like Mechanism?

 

In February, The Hindu published an article titled “Bacteria Can Talk to Each Other and Are Multilingual, Says Biologist.” The biologist in question is Bonnie Bassler, who runs a laboratory at Princeton University and has spent her career studying a process called quorum sensing in bacteria. Quorum sensing is the mechanism by which bacteria communicate and coordinate group behavior based on population density. They do this by continuously secreting and detecting chemical signaling molecules known as autoinducers. Once the bacterial population reaches a critical threshold, the resulting concentration of autoinducers triggers the synchronized activation of specific genes.

After listening to a conversation with Bassler on physicist Sean Carroll's podcast, Mindscape, I found myself wondering whether metastasis — the spread of cancer to distant organs — might occur through a similar, quorum-sensing-like mechanism.

Metastasis involves a step called the epithelial-to-mesenchymal transition (EMT), in which stationary, polarized epithelial cells lose their cell-to-cell adhesion and acquire migratory, invasive properties, becoming mesenchymal cells. This same process also plays a crucial role in embryonic development and wound healing. Within the primary tumor, cells proliferate uncontrollably and secrete enzymes called matrix metalloproteinases (MMPs), such as MMP2 and MMP9. These enzymes initiate and sustain EMT by breaking down basement membranes, degrading adhesion molecules like E-cadherin, and releasing pro-EMT signaling factors such as TGF-β from the extracellular matrix. Together, these actions drive cancer invasion and metastasis.

If quorum sensing is indeed involved in EMT, it may work as follows: in the primary tumor, cells divide uncontrollably and release MMPs, which act much like autoinducers. As the tumor cells multiply, MMP concentration rises in step with them, and once the tumor reaches a critical size, this rising concentration of MMPs triggers the synchronized activation of EMT genes. This remains a hypothesis, however, and would need to be tested directly in primary tumor cells through wet-lab experiments in tissue culture.

How Advaita Vedanta validates Many worlds interpretation of Quantum Mechanics

 How Advaita Vedanta validates Many worlds interpretation of Quantum Mechanics

In Advaita Vedanta (non-dualism) practise, when the ego construct dissolves via Yogic practices or meditation, the experience of Self  (Atman) localized to the individual is now experienced in the absence of individuality i.e. no separation from other living or non-living beings in the universe. This non-individual experience is termed Brahman-a vast infinite still field of potentialities .

In the  quantum mechanics when a measurement occurs a wave is observed as a particle. The wave is a field of potentialities and the wave function is a mathematical description of a physical system defining the probability amplitude of a particles’ probabilities. According to the many-worlds interpretation, during a measurement all possible outcomes of a quantum event occur in its own distinct universe, but the observed outcome is experienced in one universe. This measurement outcome is  similar   to the experience of a localized self i.e the atman, which is actually a part of all possible outcomes which can occur only in a field of infinite possibilities or Brahman.

The difference between Advaita Vedanta and the Many worlds interpretation of quantum mechanics is that Brahman as a field of infinite possibilities/potentialities is Self-Aware, while Many Worlds does not make any such statement.

Cancer-A story of condensates, feedback loops and the epigenome ?

 

Cancer_Hypothesis

1.Probably the epigenome of a cell is modified by an oncogenic mutation. Phenotypic plasticity/tumor heterogeneity occurs in this process.

2. This modified epigenome overrides the inhibitory signaling of tumor microenvironment via activating stemness networks. Chaos ensues.

3. The above (2) breaks cell cell interactions leading to tumor cells release from primary site and spread i.e. invasion.

4. Altered epigenome leads to epithelial mesenchymal transition.

5. Tumor cells at secondary site  undergo mesenchymal epithelial transition due to restored epigenome in a new microenvironment.

6. As critical threshold of oncogenic protein/signaling activity is breached (1) happens again.

7. A vicious cycle of tumor growth and spread ensues.

8. Altered expression/phenotype of tumor cells  containing oncogenic mutation occurs via phase transition. Mutant oncogenic proteins form multiple aggregates with their target sustrates forming numerous biomolecular condensates. Sustained oncogenic signaling occurs in biomolecular condensates which are resistant to negative feedback loops.  Membranes of such biomolecular condensates could prevent access of inhibitors to oncogenic signaling. This sustained signaling acts like a siren activating stress response pathways. Such stress response pathways could activate suppressive epigenomic enzymes in a negative feedback loop. The reason being that suppressive epigenomic enzymes such as histone deacetylases can suppress both tumor suppressor and oncogene transcription, but in a tumor it is the tumor suppressor that is silenced, but not the mutant oncogene levels. Ultimately it is cell survival regulating these feedback loops.

9. Since, the unpredictable component is how the epigenome is altered from a normal one to a cancerous one via the  oncogenic mutation,the oncogenic mutation via aberrant signaling could downregulate promoter activity of tumor suppressors via activating suppressive epigenome enzymes  like methylases.  The oncogenic mutation re-inforces its own activity positively since although the promoter of the mutant oncogene can be silenced by methylation, the methyl groups at promoters of mutant oncogenes are removed by demethylases as cell survival is the ultimate goal.

Stemness plays a role when downregulation of a tumor suppressor activates the uncontrolled  self-renewal activity of stemness networks, probably by activating oncogenic transcription factors of stemness networks that function in self-renewal.

The analogy with an Enzymatic Reaction:

Initiator-Oncogenic mutation, Epigenome alteration/Ist hit

Catalyst-Altered Tumor Microenvironment /2nd hit

Telos of the platonic realm-Inspiring the true nature of biology-Life has purpose

 

Telos of the platonic realm-Inspiring the true nature of biology-Life has purpose

 

The Greek word “telos” introduced by Aristotle , the Greek philosopher-biologist, implies purpose or cause.

In Indian philosophy kosha model, describes an outer gross layer-the food or life sheath or Annamayakosha (in Sanskrit, Anna means food), This followed internally by the pranamaya kosha or the life-force sheath, which on further depth reveals the manomaya kosha or the “mind-sheath”. The mind in Sanskrit is the inner instrument denoted as the antahkarana.

In Greek philosophy these inner subtle sheaths of life force and mind should correspond to the platonic realm or the realm of mental phenomenon. 

A key feature of annamayakosha or the life sheath is self-organization. This means the simplest living unit i.e the cell is bounded and separated from the environment by a selectively permeable membrane. This membrane allows only certain nutrients or food constituents to enter the cell, allowing the cell to survive and reproduce as an individual entity. This tendency to survive is so strong that a cancer cell spews out chemotherapeutic drugs or drugs aimed to kill a cancer  cell. I propose that this survival is not merely a Darwinian selection by the environment but an adaptation to varying environmental conditions. The goal of the single cell is to develop into multi-cellular complex species, which include human beings. The pinnacle of achievement of human beings are physical discoveries which drive science and mental discoveries which drive philosophy. Innovation is the application of discovery principles, which entails physical experiments with matter.

In Indian philosophy, primarily denoted in the Upanishad texts, self-realization is the goal of human life. This corresponds to the Greek saying of “Man know thyself”. This knowing is by being (Jnana Yoga) and doings of the mind (Raja Yoga). Knowing this way pre-supposses a mind.

At this juncture , I would like to relive the shloka or verse:

 “Asato Ma Sadgamaya, Tamasoma Jyotir Gamaya, Mrityur Ma Amritam Gamaya”. This literally translates as “May I be led from Untruth to  Truth ( Being), from darkness (ignorance) to light (knowledge) and from death (perishability) to immortality (that which does not perish)

Since the physical perishes, the above shloka is true for our mental universes. The Greek  Telos philosophy comes full circle here, as telos pre-supposes purpose, both the physical and mental have purpose, i.e the purpose of permanence. Since the physical perishes and is impermanent, the Indian philosophy of the Upanishads, says the goal of human life is to know thyself by being and this knowing never dies i.e it is imperishable.

LIFE-FORMS AS MANIFESTATION OF CONSCIOUSNESS

LIFE-FORMS AS  MANIFESTATION OF CONSCIOUSNESS

The Argument: Artificial Intelligence & Bioprinting as tools to test the Universality of Consciousness 

 Artificial Intelligence, which has learned how to assemble biomolecules and/or cell-like structures, using advanced machine learning algorithms, can instruct a 3D Bioprinter with an input of material  constituents like nucleotides, amino acids,  lipids, and in theory build cell-like machines (1). Combinations of cell-like machines with vasculature (fluids like blood encased in polymers) can give rise to 3D bioprinted tissue-like systems (2).

 

The dominant paradigm regarding consciousness in science today, is that “consciousness emerges from matter” (3,4). If that is the case, the question then arises is that why do life-forms with greater diversity (specifically in their  constituents), such as fishes or animals manifest greater functional capabilities (4,5) which is their evidence for being conscious in comparison to simpler forms like crystals with identical repeating units.

 

In contrast to the above, in the  Indian Philosophy of the Upanisads, it  has been stated that  Consciousness (Awareness) is Fundamental & Universal (6). I propose that if awareness, which I define as including sentience (“possessing living properties”) is fundamental and universal, then it will manifest itself to a greater degree, with increasing complexity of artificial intelligence directed 3D-bioprinted  agents that  express  enhanced functional capabilities. The reasoning for the above argument is as follows: If consciousness emerged from matter, then why is there such a major difference in functional properties of materials that possess simple repeating units and those that have greater diversity in their repeating units ? Consider for example a heteropolymer like DNA which has 4 basic units, i.e the 4 bases adenine (A), thymine(T), guanine(G) and cytosine( C) , (7 ) arranged in different combinations like ATGCTAGTTTCAGTGCAGCAT that can code for proteins like hair proteins, nail proteins and millions of other proteins that have different functional properties. However a homopolymer made of one unit like AAAAAAAAAAAAAAA or TTTTTTTTTTTTTT does not code for proteins with different functional properties. This shows that it is the variation or heterogeneity that is important for an outcome of functional property. Uniformity does not lead to such an outcome. Behavioral properties arise from functional properties when proteins with diverse sequences of amino acids (8 ) interact with each other within a cell, in response to stimuli at the cell surface in  a process called signal transduction (9). The interactions between diverse proteins mediated by a specific sequence of amino acids or protein motifs via complementary binding is the key. At the functional and behavioural level, it is the diversity of the interacting components that lead to a response to a stimulus, that is key property of life. Homogeneity or uniformity is unable to achieve this.

 Thus, the argument that consciousness emerges from matter fails at this point since by the above interactions, homogenous or uniform matter is dead, and varied and heterogenous matter is alive. How can matter be dead and alive at  the same time ? Infact the only argument left for materialists is that consciousness emerges from heterogenous matter that interact with each other. But then the next question that arises what is the boundary between the living and the dead ? It is like an infinite regress. If consciousness does indeed arise from matter, then it seems to be very specific types of matter arranged in highly specific configurations.

On the other hand, if consciousness is indeed the fundamental substratum of the universe, it can manifest itself through different degrees in different configurations of matter. In this scenario even a homopolymer or matter with homogeneity manifests  sentience or living properties to an extremely low extent. For example crystals, which have identical repeating subunits are capable of replication, which is a living property. Heteropolymers like DNA manifest the ability to direct the sentience of a cell , as DNA is capable of directing the formation of proteins, which have functional properties. Protein-protein interactions, protein-dna interactions result in cell behavior  that includes both metabolism and replication which are both living properties.   

I would like to propose that the role of artificial intelligence would be to use machine learning algorithms, that have learnt pattern or motif recognition from naturally occurring biomolecules like DNA and proteins which are essentially heterogenous. They would then direct the bioprinting of polymers consisting of these motifs (10,11). These biopolymers would then interact with each other in varied ways. Interactions would lead to phase transition, leading to  the creation of different fluid properties or densities of the resulting structures, that gradually progresses towards self-organization. Through the mechanism of phase transition (10), the artificial intelligence directed 3D-bioprinted agents, acquire more complex structures, functions and behavioral properties.

 

What is meant by increasing complexity? 

A salt crystal is formed by repeating units of sodium and chlorine atoms, to form a regular lattice. The coat of a virus called an "icosahedron" is made of repeating units of protein, with the smallest shape being a triangle which arranges itself with increasing complexity in terms of numbers (12). Bacteria have repeating units of coat protein surrounded by a lipid envelope. As one moves to yeast, there are fission yeasts (yeasts that split) and budding yeasts. Suddenly "things start to look different". There are fungi-zygomycetes that form round spores, ascomycetous fungi where spores are enclosed in a sac-like structure and basidiomycetous fungi where spores are arranged on club shaped structures (12).

Then we move to the plant kingdom, where the common factor is photosynthesis-but plants look different. Can one visually compare a weed, shrub, herb or a creeper? Things get more interesting in the animal kingdom where each species looks different from the other. But with more complex forms, there is more complex regulation and greater variety of functions: for example, it is no longer about eating to reproduce and survive, but there are more complex inter-species interactions for mutual benefits, or antagonistic relationships such as that of a prey and a predator, or a combination of both, for example commensalism. With increasing complexity of a species, interactions between species become more important giving rise to food chains and food webs (13). 

 

The final outcome: Predicting the evolution of life-forms

The prediction is that 3D bio-printed agents directed by Artificial Intelligence involving Machine Learning Algorithms, will show greater manifestation of Consciousness with increasing complexity. This will occur only if Consciousness/Awareness is the underlying substratum or field of the Universe. With greater manifestation of conscious agents there will be more interactions of the 3D bioprinted agents, from which will emerge the sculpting of local ecosystems as we humans along with our related species have sculpted the planet earth. So, the cycle of manifestation and interactions continues. 

I end with the following verse from the Upanisads (6):

Om purnamdah purnamidam, purnat purnamudacyate

Purnasya purnamadaya, purnam evavasisyate

 The above is translated as:  All manifest (forms and life-forms which are infinite in number), arise from the unmanifest (consciousness) which is also infinite. When one takes away the infinite manifest from the infinite unmanifest, the infinite still remains.

References:

(1)    Srikanthan Ramesh, Akash Deep, Ali Tamayol, Abishek Kamaraj, Chaitanya Mahajan, Sundararajan Madihally,Advancing 3D bioprinting through machine learning and artificial intelligence,Bioprinting,Volume38,2024,e00331,https://doi.org/10.1016/j.bprint.2024.e00331.

(2)    Murphy SV, Atala A. 3D bioprinting of tissues and organs. Nat Biotechnol. 2014 Aug;32(8):773-85. doi: 10.1038/nbt.2958. PMID: 25093879.

(3)     Mashour GA, Alkire MT. Evolution of Consciousness: Phylogeny, Ontogeny, and Emergence from General Anesthesia. In: National Academy of Sciences; Cela-Conde CJ, Lombardo RG, Avise JC, et al., editors. In the Light of Evolution: Volume VII: The Human Mental Machinery. Washington (DC): National Academies Press (US); 2014 May 19. 3. Available from: https://www.ncbi.nlm.nih.gov/books/NBK231624/

(4)    The Octopus, the Sea, and the Deep Origins of Consciousness. Peter Godfrey Smith. Talks at Google.  https://www.youtube.com/watch?v=iENXfnOobzw

(5)    Hazen Robert M, Griffin Patrick L, Carothers James M, et al. Functional Information and the Emergence of Biocomplexity. In: National Academy of Sciences; Avise JC, Ayala FJ, editors. In the Light of Evolution: Volume I: Adaptation and Complex Design. Washington (DC): National Academies Press (US); (2007). 2. Available from: https://www.ncbi.nlm.nih.gov/books/NBK254300/

(6)    Eight Upanisads: with the commentary of Sankaracharya (2006 ). 8^th impression. Publisher: Advaita Ashrama

(7)    https://bio.libretexts.org/Bookshelves/Introductory_and_General_Biology/Concepts_in_Biology_(OpenStax)/09%3A_Molecular_Biology/9.01%3A_The_Structure_of_DNA

(8)    https://bio.libretexts.org/Bookshelves/Biochemistry/Fundamentals_of_Biochemistry_(Jakubowski_and_Flatt)/01%3A_Unit_I-_Structure_and_Catalysis/03%3A_Amino_Acids_Peptides_and_Proteins/3.2%3A_The_Structure_of_Proteins-_An_Overview

(9)    https://bio.libretexts.org/Bookshelves/Cell_and_Molecular_Biology/Book%3A_Cells_-_Molecules_and_Mechanisms_(Wong)/14%3A_Signal_Transduction

 

(10)Kotova S, Kostjuk S, Rochev Y, Efremov Y, Frolova A, Timashev P. Phase transition and potential biomedical applications of thermoresponsive compositions based on polysaccharides, proteins and DNA: A review. Int J Biol Macromol. 2023 Sep 30;249:126054. doi: 10.1016/j.ijbiomac.2023.126054. Epub 2023 Jul 31. PMID: 37532189.

(11)Wang X. Advanced Polymers for Three-Dimensional (3D) Organ Bioprinting. Micromachines (Basel). 2019 Nov 25;10(12):814. doi: 10.3390/mi10120814. PMID: 31775349; PMCID: PMC6952999.

(12)Prescott’s Microbiology. (2020). 11^th edition Publisher: Mc Graw Hill Education.

(13)https://bio.libretexts.org/Courses/Coastline_College/ENVS_C100%3A_Environmental_Science_(Hoerer)/03%3A_Ecology/3.03%3A_Communities/3.3.01%3A_Biotic_Interactions/3.3.1.01%3A_Trophic_Interactions/3.3.1.1.04%3A_Food_Chains_and_Food_Webs

 

 

 

 

 

My Association with HIV Reverse Transcriptase

 My Association with HIV Reverse Transcriptase:

Just saw on linkedin: Dr. David Baltimore, Nobel prize winner  & co-discoverer of HIV-1 Reverse Transcriptase, passes away at 87.

The central dogma of molecular biology involves DNA-the molecule which contains genes, that is    transcribed into RNA, which is eventually made into protein. However an enzyme (proteins that speed up or catalyze reactions within cells) in human immunodeficiency virus (HIV) reverse transcribed RNA into DNA. This went against the central dogma of molecular biology. Researchers Howard Temin & David Baltimore were awarded the Nobel prize for this discovery (1975) , https://www.nobelprize.org/prizes/medicine/1975/baltimore/facts/  

My tryst with HIV Reverse Transcriptase began  in 1999, when I joined Prof. Monica Roth's Laboratory as a graduate research fellow, post a successful laboratory rotation. This was in the Molecular Biosciences program jointly hosted by Rutgers-UMDNJ, New Jersey USA. I picked a project which involved HIV-1 Reverse Transcriptase. It was a protein modeling project.

HIV-1 Reverse Transcriptase has two functional domains: a polymerase which makes the double stranded DNA polymer and an Rnase H domain which breaks down the RNA component (derived from HIV and also the tRNA primer) of the RNA-DNA hybrids, so as to form a full double stranded DNA genome ,that can integrate into the host cell DNA and remain as a provirus. Prof. Roth had designed a polypeptide minus the polymerase domain, so as to  screen for inhibitors of HIV-1 RNaseH enzyme only.

It took 6 months to clone the polypeptide. This was followed by purification  and testing activity of this polypeptide on hybrid RNA-DNA substrates, in the presence of manganese, which took two and a half years. These findings culminated in a paper in 2004, and the design made to the cover of the  journal: Protein Engineering Design & Selection (PEDS):

https://academic.oup.com/peds/article-abstract/17/7/581/1553405

This designed polypeptide formed the precursor to an RnaseH  polypeptide that functioned in the physiological cation, Magnesium, and a subsequent paper from Prof. Roths laboratory.

Interestingly , when I co-wrote a book chapter , on DNA viruses containing reverse transcriptases;

https://www.taylorfrancis.com/chapters/edit/10.1201/9781003369349-15/dna-viruses-containing-reverse-transcriptase-sonali-sengupta-baibaswata-nayak ,we included the Baltimore classification of viruses.

So Prof. David Baltimore has indirectly played an invaluable role in catalysing my growth as a researcher , and this blogpost is in memory of this great scientist. I bow to him with humility.

AI & 3D bioprinting

 A combination of Artificial Intelligence (which has learned how to assemble an artificial cell) that  gives instructions to the 3D Bioprinter with an input of  cellular constituents, can in theory build cellular machines.

Combinations of cells with vasculature can give rise to 3D bioprinted tissues,organs, organ systems & eventually organisms.

If Consciousness (Awareness) is Fundamental & Universal then it will express itself to a greater degree manifesting enhanced capabilities with increasing complexity of 3D- bioprinted  agents.

What do I mean by increasing complexity? 

A salt crystal is formed by repeating units of sodium and chlorine atoms to form a regular lattice. The coat of a virus called an "icosahedron" is made of repeating units of protein, with the smallest shape being a triangle which arranges itself with increasing complexity in terms of numbers. Bacteria have repeating units of coat protein surrounded by a lipid envelope. As one moves to yeast, there are fission yeasts (yeasts that split) and budding yeasts. Suddenly "things start to look different". There are fungi-zygomycetes that form round spores, ascomycetous fungi where spores are enclosed in a sac like structure and basidiomycetous fungi where spores are arranged on club shaped structures.

Then we move to the plant kingdom, where the common factor is photosynthesis-but plants look different. Can you really visually compare a weed, shrub, herb or a creeper ? Things get more interesting in the animal kingdom where each species looks different from the other. But with more complex forms, there is more complex regulation and greater variety of functions for example it is no more about eating to reproduce and survive, but there are more complex inter-species interactions for mutual benefits, or antagonistic relationships such as that of a prey and a predator, or a combination of both , for example commensalism. So with increasing complexity of a species, interactions between species become more important giving rise to food chains and food webs. 

The prediction is that 3D bio-printed agents directed by Artificial Intelligence involving Machine Learning Algorithms, will show greater manifestation of Consciousness with increasing complexity, if Consciousness/Awareness is the underlying substratum/field of the Universe. With greater manifestation of conscious agents there will be more interactions of the 3D bioprinted agents, from which will emerge the sculpting of local ecosystems as we humans aong with our related species have sculpted the planet earth. So, the cycle of manifestation and interactions continues. 

I end with the following:

   

 All manifest forms and life-forms which are infinite, arise from the unmanifest which is also infinite. When one takes away the infinite manifest from the infinite unmanifest, the infinite still remains.

                   II SHANTIH II 

Cancer Vaccine-ADJUVANT THERAPY

 Assumption 

The theoretical assumption is that,   neo-antigens in tumor cells are probably oncogenes which may be poorly presented on the cell surface. This could be due to low expression levels, or inappropriate interaction of cell-surface neo-antigens, with MHC II molecules, more specifically the  inhibitory peptide. This inhibitory peptide, could form unstable complexes with the neo-antigen and MHC II, resulting in failed neoantigen-presentation. Thus the tumor survivesthe   immunosurveillance process.

The tumor suppressor polypeptide (based on the amino acid sequence) could fold in such a way that it forms stable complexes with MHC II, that is not inhibited by the inhibitory peptide. This leads to proper antigen-presentation. In this instance, the tumor is targeted by the immune system (cell-defense mechanism) and gets eliminated.

A successful cancer vaccine would override the above biology, for example an adjuvant such as an emulsion, could cloak the inhibitory peptide in the case of a neo-antigen/oncogenic polypeptide resulting in stable complexes, that leads to successful antigen-presentation, and elimination of the tumor.

Therapy/Cure ensues.      

Cellular_Metastasis

THEORY Of METASTASIS  : (Metastatic Cancer is the NEMESIS) 

Tumorigenesis :

During tumor initiation, cells intially divide, to form a cluster of cells. This cell division, is based on the evolutionary theory of Darwin, i.e. natural selection.

Tumor cell circulation :

 These cluster of cells, circulate through blood in inhospitable environments, to newer sites. At the newer sites, they secrete tumor-suppressive molecules which block inhibitory factors, that prevent the seeding of cancer seed cells in newer environments. This leads to the hypothesis that the transcriptional machinery (involving RNA and transcriptional factors),  adsorbed by the promoters of tumor-suppressors. The assumption is that, the quantitative relation between oncogenes and tumor-suppressors is an inverse one. 

Metastasis :

With excessive levels of tumor suppressors, a negative feedback loop functions to prevent apoptosis (programmed cell death), of cells  in-order that cell survival ensues. This leads to the increase in levels of oncogenes to counteract the excessive levels of tumor-suppressors,that could be termed as ADAPTATION (Jean-Baptiste Lamarck; French Natural Philosopher); further increase in oncogenic levels/activity ensues, leading to cell division and and metastatic tumors at secondary sites. 

Nomenclature (Terminology)

This progress of events could be termed Dar-Lam-Da or alternatively Darwinian survival-Lamarckian Adaptation followed by Darwinian survival.          

 

(Lyrics):

https://www.youtube.com/watch?v=S4kzGhDEURA

Tumorigenesis-Tumor as a Condensate

 A tumor is like a condensate, analogous to the precipitation of de-differentiated cells. 

Differentiated cells, overcome some kind of energy barrier (Waddingtons epigenetic landscape) and de-differentiate from defined structure to an un-defined mass of cells.

These mass of cells lose their definitive interactions (epithelial mesenchymal transition) and condense to a solid mass.

Mapping the Mind

 In the psychology tradition, there are 16 personality types, based on the following characteristic traits in various permutations:

Introversion/Extroversion, Intuitive/Logical, Thinking/Feeling, Judging/Perceiving.

In the yoga tradition, there are three attributes of the mind: Sattva (Calmness/Balance), Rajas (Energy/Activity), Tamas (Dullness/Laziness).

In the Vedanta Tradition there are five sheaths from the depth to the surface: They are annamayakosha (food sheath), pranamayokosha (vital energy sheath), manomayakosha (mind sheath), vigyanmayokosha (intellect sheath), anandamayokosha (bliss sheath). 

The three gunas of Sattva, Rajas, Tamas belong to manomayokosha. These three gunas in various permutations are expressed as the personality types.

For example Introversion is correlated with Sattva, Extroversion with Rajas. Clear thinking with Sattva and feeling or emotions with Rajas; Judging with tamas and Perceiving with sattva. Intuitive,Logical both with Sattva. 

So an INTP (Introversion, Intuitive, Thinking, Perceiving) personality trait has the predominant qualities of Sattva.

The above-mentioned correlations can be used as a technique for mapping the human mind and its expression as personality traits.

Activity and Stillness

 Anaesthetic mediated stilling of brain activity versus non-anaesthetic mediated stillnes

 

The Prior - Consciousness expresses itself in and via dynamically functioning neurons.

The floor of a neuronal cell, consists of microtubules and actin filaments. The microtubules intercalate to form a dynamically functioning network, that expands and contracts according to cell activity. This is analogous to sarcomere filaments in contracting and expanding muscle.

The expansion and contraction of the microtubule filaments, lead to a rhythmic oscillation pattern, that manifests itself in a dynamically functioning neuronal cell, transmitting information via secreted neurotransmitters. In other words microtubules act upstream of nerve impulse transmission.

When anaesthesia is administered to a living organism, the anaesthetic treatment locks the intercalation, inhibiting nerve impulse transmission, resulting in progressive diminishment  of the rhythmic oscillation pattern of neuronal firing.

This anaesthesia mediated diminshment of neuronal firing, is different from stillness acquired through meditation. The anaesthetic treatment physically affects the neuronal network architecture, which leads to involuntary collapse of the brain. Meditation is the voluntary stilling of neuronal activity by affecting neurotransmitter mediated nerve firing, without affecting neuronal architecture.

The former leads to collapse of the living organism if administered in excess. The latter in the case of a human being, leads to illumination of mind activity in a still background, which in other words is called liberation of the mind via enlightenment

Bayesian Brain

 We humans possess a Bayesian brain, which implies that our prior memories/experiences/expectations determine our newer experience. It is a pre-conditioned brain that perceives.

This pre-conditioning is partly determined by the free energy principle which states that the difference in free energy between our prior brain states and brain states following the particular experience  that is the least, is the one that is selected and retained as an experience/memory. This difference in free energy could be alternatively termed, "minimize surprise". 

For further reading:

https://www.youtube.com/watch?v=NIu_dJGyIQI&t=35s

 

Hologram of CD markers on cell surfaces

 The CD markers (Cluster of Differentiation) pertaining to cells of the immune system, that are on the cell surface are depicted in textbooks in a linear array.

But a cell has a 3-Dimensional geometry. Thus the arrangement of CD markers exhibits topological features, and it is a misnomer to name it as a cluster.Rather name them as differentiation markers, or more specifically, an Array of Differentiation markers (AD markers). This points to a matrix-like arrangement of cell surface markers as compared to a linear array.

Depending on the sequence of connecting the dots, a different network of markers emerge.  Similarly, a different set of CD markers on various cell types will have different 3D topological arrangements. This is simiar to a country with different cities lighted up. Cells to Cities ---> FRACTALS.

 

A Subjective Approach to the Scientific Method

 A Subjective Approach to the Scientific Method

This essay proposes a radical paradigm shift in thinking, from the traditionally practiced, hypothesis driven- research data collection-research data analysis driven scientific method, to a richer and more comprehensive subjective approach to the scientific method. The subjective approach is proposed to complement and advance the traditional objective approach, in order to drive scientific research in the direction of asking more insightful original research questions, develop innovative research methods and implement more in-depth research  data analyses. The subjective approach aims to address human researcher centered cognitive biases, in other words anthropocentric cognitive  biases.

 The premise of the subjective approach is based on the Indian philosophical inquiry  field of Advaita Vedanta (https://en.wikipedia.org/wiki/Advaita_Vedanta ), which in the collected text format is available as the Upanisads (https://en.wikipedia.org/wiki/Upanishads ),  and the psychological practice of Raja-Yoga ( https://en.wikipedia.org/wiki/R%C4%81ja_yoga ) which is based on Patanjali’s Yoga Sutras.

For this essay, the philosophical premise of Advaita Vedanta is taken to be the perspective that the world of objects is a world of appearance which is everchanging and impermanent and is superimposed on an underlying all-pervasive substratum, which is the subjective observer. The psychological practice of Raja-Yoga is the intuitive understanding based on yogic experience of the human being as consisting of five koshas i.e.sheaths( https://en.wikipedia.org/wiki/Kosha)superimposing on the individual self, the metaphysical I, which is a witness to the thought process. (Drg Drsya Viveka https://en.wikipedia.org/wiki/D%E1%B9%9Bg-D%E1%B9%9B%C5%9Bya-Viveka ). These sheaths from the outside to the inside are, annamayakosha (food-sheath), pranamayakosha (vital-energy sheath), manomayakosha (mind i.e. recorder of perceptions sheath), vigyanmayakosha (intellect sheath), and anandamayakosha (bliss sheath). The practice of Raja-Yoga which incudes regulation of the prana in the pranamayakosha or  vital-energy sheath, regulates the erratic energy flow in the human body where a pre-conditioned mind predominates. A human mind trained by Raja-Yoga practice has balanced energy flow throughout the body, and is going through progressive stages of de-conditioning of priors. Such a deconditioned mind is  highly concentrated and is able to provide clearer insights into the objects it gives its attention to. Practioners of Raja-Yoga, do not succumb to erratic and compulsive behaviours, and possess  a calm analytical mind as opposed to a reactive mind.

In the following passages I have provided practical examples of how the practioners of the above philosophical inquiry method and  yogic practice may advance  the field of scientific research investigation, in the areas of:  asking insightful research questions, developing innovative research methods, implementing in-depth research data analysis, as well as addressing confirmation bias.

Asking more in-depth original research questions: A traditional hypothesis and/or data-driven researcher may ask the question, what is the reason that the leaf of a tree is green. The given answer is the leaf is green due to the pigment chlorophyll, which drives the photosynthesis process that manufactures, sugars from carbon dioxide and water in the presence of sunlight. A scientific researcher well-versed in the Advaita vedantic philosophical inquiry would ask the question, why does the leaf of a tree appear green to humans, as opposed to a cat seeing a grey leaf. Does the subject i.e, human perceptive apparatus, play a role in the outcome of the observation of a leaf appearing green? Is the green leaf observation an anthropocentric observation?

Implementing more in-depth research methods: A  traditional hypothesis and/or data-driven researcher may  shed light on the mechanism of how a leaf exchanges energy with its surroundings via biochemical investigative methods and tools. A scientific researcher well-versed with Raja-Yoga practice may implement an innovative  research method based on the observation that since both the subject i.e. human observer and the object i.e. the tree, exchanges energy with the surroundings, why is it that the human subject can self-regulate its inner vital-energy flow, as well as exchange air with its surroundings via breath, while a tree is dependent on an outer clean environment to provide air, sunlight and water to it. An innovative method can be implemented by such a researcher, who designs  a panel of external and internal parameters that differentially compares energy exchange and flow with respect to the object i.e. the tree and its environment, the human subject and its environment, as well as energy flow in the subject-object system i.e. human-tree sub- system and the human-tree-environment system 

In-depth Research Data Analyses:  A  traditional hypothesis and/or data-driven researcher may compare the patterns of similarities and dissimilarities , during bioinformatic analyses of gene sequences of closely evolutionarily related organisms. A scientific researcher well-versed in  Advaita vedantic philosophical inquiry would ask whether the patterns of similarities and/or dissimilarities that  appear via bioinformatic data analyses, are fixed/static or changing as an organism, adapts to its environment ? If the patterns are changing over time, then what is the time-scale over which old patterns disappear and new patterns appear? Thus the research database does not become a fixed entity, but an evolving one.

Addressing human researcher cognitive biases: A scientific researcher well-versed in Raja-Yoga practice, may question their own conditioned priors leading to cognitive biases, such as confirmation bias (https://en.wikipedia.org/wiki/Confirmation_bias ). For example if the researcher reads an article that confirms data from their own laboratory or confirms their hypothesis, since the researchers have evolved priors via Raja-Yoga practice  resulting in a  clearer less conditioned mind, the researcher may develop in-depth insights into the confirmatory research data or article and ask insightful original questions which furthers the research field.

So, from the above examples we can see that a subjective approach to the scientific method complements the traditional object driven approach by  advancing  science from a static body of facts, to an evolving dynamic entity contingent  on contextual perspectives.

The case for a therapeutic cancer vaccine

The case for a therapeutic cancer vaccine

                              

                               Anti-Cancer drugs: A prelude

RAS proteins are important for normal development. Active RAS drives the growth, proliferation, and migration of cells. In normal cells RAS receives signals and obeys those signals to rapidly switch between the active (GTP) form and the inactive (GDP form) states. Mutated RAS* is stuck in the active state, ignores signals to the contrary, and drives cells to become cancerous. 

https://www.cancer.gov/research/key-initiatives/ras/about

Despite repeated attempts, researchers failed to develop a drug that could inhibit the activity of RAS proteins in cancers. They had hoped to find a small molecule that could preferentially bind the unique features of the RAS protein, but they couldn’t find a surface on the protein that would bind a drug.https://www.cancer.gov/research/key-initiatives/ras/about

It is being increasingly recognized that cell signaling is being carried out via phase separation of liquid compartments consisting of the signaling components.

https://pubmed.ncbi.nlm.nih.gov/31792379/

https://pubmed.ncbi.nlm.nih.gov/32203417/

 I hypothesize that  since, the mutant ras protein is stuck in an active signaling state, there should be a greater number of phase separated droplets in a cell carrying the mutant ras protein versus the wild-type ras protein. An effective drug should be able to inhibit the formation of these phase separated droplets.

In the 2010s, the Shokat Lab at the University of California San Francisco and the Fesik Lab at Vanderbilt University developed innovative drug screening and medicinal chemistry techniques that identified molecules that could bind mutated KRAS proteins. https://www.cancer.gov/research/key-initiatives/ras/about 

Rationally designed drugs, may be used to target, matrix metallo-proteinases and collagenases, which are "ENZYMES" that function, to degrade the extracellular substrate in the tumor micro-environment,so as to inhibit cancer cells, escaping from the primary tumor into circulation, to establish secondary metastases. However, such drugs are works in progress.

                                       The case..

Since many challenges exist toward developing effective anti-cancer drugs, another approach would be to develop a therapeutic anti-metastatic cancer vaccine, directed specifically toward the antigen profile of circulating tumor cells, that express altered levels and types of cell-surface biomarkers. The goal would be a multi-epitope anti-metastatic therapeutic cancer vaccine.

Such a vaccine would prevent secondary metastases, since data support the idea that the majority of deaths from solid tumors are caused by metastases. https://pubmed.ncbi.nlm.nih.gov/31397113/ 

When the drug fails to contain the primary tumor (anti-cancer drug resistance), the anti- metastatic cancer vaccine could prevent the spread of the primary tumor to secondary sites, by targeting tumor cells  in circulation.

Self, Mind in Biology and Yog-Vedanta explained mechanistically

 Self, Mind in Biology and Yog-Vedanta explained mechanistically

The emergent mind in biology, also called the embodied  mind, is  due to  interactions between and within cells in the living organism, in organs throughout the body such as brain, heart etc . This is the biological basis of thought which occurs in the embodied mind. The physics of an emergent mind involves mechanisms of phase transition, the chemistry involves interactions between and within cells, the biology involves organization of cells in tissues and organs,  and the math involves fractal (self-similar) patterns of interactions.

The underlying mind according to the psychological practical experience of  Yog, specifically Raja-Yog which encompasses techniques of meditation, involves manas (recorder of perceptions), chitta (memory bank), buddhi (the determinative faculty , deciding the pros and cons-is this a chair or not) and ahamkara (the individualization capacity). The underlying mind has three attributes i.e, sattva (balance/harmony), rajas (activity) and tamas (inertia), which collectively constitute prakriti or internal nature.

Both the emergent, embodied mind and the underlying mind which identifies with the body, are subtle matter. During meditation, such as object based   meditation where one repeatedly dwells on sound and the mantra (words with meaning), when the underlying mind vibrational activity is stilled, because the mind is focused on the mantra, away from thoughts, the mind state is termed “chitt vritti nirodh” or literally translated into  mind activity stopped, the witness to mind activity is revealed. This witness to the mind activity is termed Purusha in Yog or Atman in Vedanta , which is translated as Self. The mind activity is movement or moving energy, and since movement can only be relative to that which is unmoving, the self is inert or inert energy.

In the experience of  meditation  this self in context of an  individual human being, termed Atman, is equated to the selves in all living beings, and pervades the entire physical and mental universes, which is termed Brahman or the underlying universal self. Brahman/Atman is inert unmoving/still energy and thus cannot be quantified or measured, while mental activity or moving energy i.e. Prakriti or Shakti, can be quantified or measured. This equation of Atman =Brahman, is the conclusion of A-dvaita (Non-dual) Vedanta , and can be intuited by rational enquiry of clear minds. This philosophical rational enquiry is the process  or technique of Jnana-Yog also termed Advaita Vedanta.

 According to Sri Ramakrishna, through practice of meditation, Brahman and shakti are identical, and he uses the analogy of fire and its power to burn.

The various states of samadhi which are a culmination of Yogic practice are degrees  of revelation of the Purusha, via Raj-Yog practice. The chakras in the Raja-Yog systematic practice are areas of concentrated energy, which are experienced. The energy chakras dealing with food/eating, sexual activity and excretion of waste products are dense, like tied knots. With advanced and sustained Yogic meditation, the knotted energy gets progressivley  untied, and energy chakra becomes lighter, as in the heart or anahata chakra. With progressive sustained meditation, the person feels happier, lighter and cheerful.

Sat-Chit-Ananda literally translated into Truth/Being-Consciousness-Bliss, can be narrated as when, mind activity is stilled, the ground of truth  i.e being is experienced and manifested as bliss. People experiencing bliss, manifest transformative behaviours such as calmness, eveness of mind (Stithaprajna), humility etc. This is the reason Swami Vivekananda said “Religion is realization” not talk, theory or intellectual consent. Realization is the lived experience of brahman, (Knowing by Being), the underlying non-quantifiable stillness, and a realized or enlightened person, manifests transformed behaviour, exhibiting kindness, compassion etc. Realization can also be termed as liberation from mental activity or “mukti/moksha”.

The basis of oneness/unity or connectedness of physical and mental universes, is this underlying still continuity which is termed Brahman in Vedanta. This Brahman is termed God, and Atman or the individualized self, is termed Ishvara (inner controller) or antaryamin or (inner seer).

It is the practice that finally matters, so that stillness, which feels as bliss is a lived experience.

The following is speculation: In the concept of re-birth, at death  the body decomposes, while the mental activity remains as a set of vibrations or forms a vibratory footprint. At conception, when  the sperm  physically, fuses with the egg to form the zygote it provides the environment for the vibratory footprint to take a home, and interactions of this vibratory footprint with its zygotic environment , produces a conscious living organism. The living organisms, takes in food from its environment and develops systematically into an adult human. The tendencies developed by a human being are not ony inherited, but coming from previous births. A realized or enlightened human, who has transcended mental activity no longer takes re-birth.

The physicist David Bohm, talks about wholeness and fragmentation. The wholeness refers to Brahman/Unity and fragmentation to vibratory mental activity.   

 

Cancer Research in the Context of Organoid Biology

 One of the  goals of biology research is to simulate the native architecture of tissues, so that one can study cells in their "natural environments".

A step towards this goal is the development of organoid systems.

Organoid systems are the cultures of stem cells in a three-dimensional environment, i.e. a matrigel, which develop over time in the presence of requisite growth factors into tissue-like structures. 

Self-organization into tissue-like structures, is a crowning achievement of invitro cell biology. What remains to be included is the vasculature, which can be incorporated by mixing the matrigel and microfluidics systems, with various technological approaches.

In the cancer context the stem cells, maybe replaced by cancer stem cells (patient derived/cell line derived) for primary tumors and circulating tumor cells for metastatic cancer.

The above system, may then be utilized for testing anti-cancer compounds, or even used to determine cancer related signatures in their native microenvironments. This information may inform the development of therapeutic cancer vaccines, which can be applied to patients with early diagnosis (depending on the stage), to prevent full blown development to metastastic cancer  which is fatal.

Ref:https://pubmed.ncbi.nlm.nih.gov/31550983/