Sunday, 14 September 2025

LIFE-FORMS AS MANIFESTATION OF CONSCIOUSNESS

LIFE-FORMS AS  MANIFESTATION OF CONSCIOUSNESS

The Argument: Artificial Intelligence & Bioprinting as tools to test the Universality of Consciousness 

 Artificial Intelligence, which has learned how to assemble biomolecules and/or cell-like structures, using advanced machine learning algorithms, can instruct a 3D Bioprinter with an input of material  constituents like nucleotides, amino acids,  lipids, and in theory build cell-like machines (1). Combinations of cell-like machines with vasculature (fluids like blood encased in polymers) can give rise to 3D bioprinted tissue-like systems (2).

 

The dominant paradigm regarding consciousness in science today, is that “consciousness emerges from matter” (3,4). If that is the case, the question then arises is that why do life-forms with greater diversity (specifically in their  constituents), such as fishes or animals manifest greater functional capabilities (4,5) which is their evidence for being conscious in comparison to simpler forms like crystals with identical repeating units.

 

In contrast to the above, in the  Indian Philosophy of the Upanisads, it  has been stated that  Consciousness (Awareness) is Fundamental & Universal (6). I propose that if awareness, which I define as including sentience (“possessing living properties”) is fundamental and universal, then it will manifest itself to a greater degree, with increasing complexity of artificial intelligence directed 3D-bioprinted  agents that  express  enhanced functional capabilities. The reasoning for the above argument is as follows: If consciousness emerged from matter, then why is there such a major difference in functional properties of materials that possess simple repeating units and those that have greater diversity in their repeating units ? Consider for example a heteropolymer like DNA which has 4 basic units, i.e the 4 bases adenine (A), thymine(T), guanine(G) and cytosine( C) , (7 ) arranged in different combinations like ATGCTAGTTTCAGTGCAGCAT that can code for proteins like hair proteins, nail proteins and millions of other proteins that have different functional properties. However a homopolymer made of one unit like AAAAAAAAAAAAAAA or TTTTTTTTTTTTTT does not code for proteins with different functional properties. This shows that it is the variation or heterogeneity that is important for an outcome of functional property. Uniformity does not lead to such an outcome. Behavioral properties arise from functional properties when proteins with diverse sequences of amino acids (8 ) interact with each other within a cell, in response to stimuli at the cell surface in  a process called signal transduction (9). The interactions between diverse proteins mediated by a specific sequence of amino acids or protein motifs via complementary binding is the key. At the functional and behavioural level, it is the diversity of the interacting components that lead to a response to a stimulus, that is key property of life. Homogeneity or uniformity is unable to achieve this.

 Thus, the argument that consciousness emerges from matter fails at this point since by the above interactions, homogenous or uniform matter is dead, and varied and heterogenous matter is alive. How can matter be dead and alive at  the same time ? Infact the only argument left for materialists is that consciousness emerges from heterogenous matter that interact with each other. But then the next question that arises what is the boundary between the living and the dead ? It is like an infinite regress. If consciousness does indeed arise from matter, then it seems to be very specific types of matter arranged in highly specific configurations.

On the other hand, if consciousness is indeed the fundamental substratum of the universe, it can manifest itself through different degrees in different configurations of matter. In this scenario even a homopolymer or matter with homogeneity manifests  sentience or living properties to an extremely low extent. For example crystals, which have identical repeating subunits are capable of replication, which is a living property. Heteropolymers like DNA manifest the ability to direct the sentience of a cell , as DNA is capable of directing the formation of proteins, which have functional properties. Protein-protein interactions, protein-dna interactions result in cell behavior  that includes both metabolism and replication which are both living properties.   

I would like to propose that the role of artificial intelligence would be to use machine learning algorithms, that have learnt pattern or motif recognition from naturally occurring biomolecules like DNA and proteins which are essentially heterogenous. They would then direct the bioprinting of polymers consisting of these motifs (10,11). These biopolymers would then interact with each other in varied ways. Interactions would lead to phase transition, leading to  the creation of different fluid properties or densities of the resulting structures, that gradually progresses towards self-organization. Through the mechanism of phase transition (10), the artificial intelligence directed 3D-bioprinted agents, acquire more complex structures, functions and behavioral properties.

 

What is meant by increasing complexity? 

A salt crystal is formed by repeating units of sodium and chlorine atoms, to form a regular lattice. The coat of a virus called an "icosahedron" is made of repeating units of protein, with the smallest shape being a triangle which arranges itself with increasing complexity in terms of numbers (12). Bacteria have repeating units of coat protein surrounded by a lipid envelope. As one moves to yeast, there are fission yeasts (yeasts that split) and budding yeasts. Suddenly "things start to look different". There are fungi-zygomycetes that form round spores, ascomycetous fungi where spores are enclosed in a sac-like structure and basidiomycetous fungi where spores are arranged on club shaped structures (12).

Then we move to the plant kingdom, where the common factor is photosynthesis-but plants look different. Can one visually compare a weed, shrub, herb or a creeper? Things get more interesting in the animal kingdom where each species looks different from the other. But with more complex forms, there is more complex regulation and greater variety of functions: for example, it is no longer about eating to reproduce and survive, but there are more complex inter-species interactions for mutual benefits, or antagonistic relationships such as that of a prey and a predator, or a combination of both, for example commensalism. With increasing complexity of a species, interactions between species become more important giving rise to food chains and food webs (13). 

 

The final outcome: Predicting the evolution of life-forms

The prediction is that 3D bio-printed agents directed by Artificial Intelligence involving Machine Learning Algorithms, will show greater manifestation of Consciousness with increasing complexity. This will occur only if Consciousness/Awareness is the underlying substratum or field of the Universe. With greater manifestation of conscious agents there will be more interactions of the 3D bioprinted agents, from which will emerge the sculpting of local ecosystems as we humans along with our related species have sculpted the planet earth. So, the cycle of manifestation and interactions continues. 

I end with the following verse from the Upanisads (6):

Om purnamdah purnamidam, purnat purnamudacyate

Purnasya purnamadaya, purnam evavasisyate

 The above is translated as:  All manifest (forms and life-forms which are infinite in number), arise from the unmanifest (consciousness) which is also infinite. When one takes away the infinite manifest from the infinite unmanifest, the infinite still remains.


References:

(1)    Srikanthan Ramesh, Akash Deep, Ali Tamayol, Abishek Kamaraj, Chaitanya Mahajan, Sundararajan Madihally,Advancing 3D bioprinting through machine learning and artificial intelligence,Bioprinting,Volume38,2024,e00331,https://doi.org/10.1016/j.bprint.2024.e00331.

(2)    Murphy SV, Atala A. 3D bioprinting of tissues and organs. Nat Biotechnol. 2014 Aug;32(8):773-85. doi: 10.1038/nbt.2958. PMID: 25093879.

(3)     Mashour GA, Alkire MT. Evolution of Consciousness: Phylogeny, Ontogeny, and Emergence from General Anesthesia. In: National Academy of Sciences; Cela-Conde CJ, Lombardo RG, Avise JC, et al., editors. In the Light of Evolution: Volume VII: The Human Mental Machinery. Washington (DC): National Academies Press (US); 2014 May 19. 3. Available from: https://www.ncbi.nlm.nih.gov/books/NBK231624/

(4)    The Octopus, the Sea, and the Deep Origins of Consciousness. Peter Godfrey Smith. Talks at Google.  https://www.youtube.com/watch?v=iENXfnOobzw

(5)    Hazen Robert M, Griffin Patrick L, Carothers James M, et al. Functional Information and the Emergence of Biocomplexity. In: National Academy of Sciences; Avise JC, Ayala FJ, editors. In the Light of Evolution: Volume I: Adaptation and Complex Design. Washington (DC): National Academies Press (US); (2007). 2. Available from: https://www.ncbi.nlm.nih.gov/books/NBK254300/

(6)    Eight Upanisads: with the commentary of Sankaracharya (2006 ). 8th impression. Publisher: Advaita Ashrama

(7)    https://bio.libretexts.org/Bookshelves/Introductory_and_General_Biology/Concepts_in_Biology_(OpenStax)/09%3A_Molecular_Biology/9.01%3A_The_Structure_of_DNA

(8)    https://bio.libretexts.org/Bookshelves/Biochemistry/Fundamentals_of_Biochemistry_(Jakubowski_and_Flatt)/01%3A_Unit_I-_Structure_and_Catalysis/03%3A_Amino_Acids_Peptides_and_Proteins/3.2%3A_The_Structure_of_Proteins-_An_Overview

(9)    https://bio.libretexts.org/Bookshelves/Cell_and_Molecular_Biology/Book%3A_Cells_-_Molecules_and_Mechanisms_(Wong)/14%3A_Signal_Transduction

 

(10)Kotova S, Kostjuk S, Rochev Y, Efremov Y, Frolova A, Timashev P. Phase transition and potential biomedical applications of thermoresponsive compositions based on polysaccharides, proteins and DNA: A review. Int J Biol Macromol. 2023 Sep 30;249:126054. doi: 10.1016/j.ijbiomac.2023.126054. Epub 2023 Jul 31. PMID: 37532189.

(11)Wang X. Advanced Polymers for Three-Dimensional (3D) Organ Bioprinting. Micromachines (Basel). 2019 Nov 25;10(12):814. doi: 10.3390/mi10120814. PMID: 31775349; PMCID: PMC6952999.

(12)Prescott’s Microbiology. (2020). 11th edition Publisher: Mc Graw Hill Education.

(13)https://bio.libretexts.org/Courses/Coastline_College/ENVS_C100%3A_Environmental_Science_(Hoerer)/03%3A_Ecology/3.03%3A_Communities/3.3.01%3A_Biotic_Interactions/3.3.1.01%3A_Trophic_Interactions/3.3.1.1.04%3A_Food_Chains_and_Food_Webs