LIFE-FORMS AS MANIFESTATION OF CONSCIOUSNESS
The Argument:
Artificial Intelligence & Bioprinting as tools to test the Universality of
Consciousness
Artificial Intelligence, which has learned how
to assemble biomolecules and/or cell-like structures, using advanced machine
learning algorithms, can instruct a 3D Bioprinter with an input of material
constituents like nucleotides, amino
acids, lipids, and in theory build cell-like
machines (1). Combinations of cell-like machines with vasculature (fluids like
blood encased in polymers) can give rise to 3D bioprinted tissue-like systems
(2).
The dominant
paradigm regarding consciousness in science today, is that “consciousness
emerges from matter” (3,4). If that is the case, the question then arises is
that why do life-forms with greater diversity (specifically in their constituents), such as fishes or animals manifest
greater functional capabilities (4,5) which is their evidence for being
conscious in comparison to simpler forms like crystals with identical repeating
units.
In contrast to
the above, in the Indian Philosophy of
the Upanisads, it has been stated that Consciousness (Awareness) is Fundamental &
Universal (6). I propose that if awareness, which I define as including
sentience (“possessing living properties”) is fundamental and universal, then
it will manifest itself to a greater degree, with increasing complexity of artificial
intelligence directed 3D-bioprinted agents that express enhanced functional capabilities. The
reasoning for the above argument is as follows: If consciousness emerged from
matter, then why is there such a major difference in functional properties of
materials that possess simple repeating units and those that have greater
diversity in their repeating units ? Consider for example a heteropolymer like
DNA which has 4 basic units, i.e the 4 bases adenine (A), thymine(T), guanine(G)
and cytosine( C) , (7 ) arranged in different combinations like ATGCTAGTTTCAGTGCAGCAT
that can code for proteins like hair proteins, nail proteins and millions of
other proteins that have different functional properties. However a homopolymer
made of one unit like AAAAAAAAAAAAAAA or TTTTTTTTTTTTTT does not code for
proteins with different functional properties. This shows that it is the
variation or heterogeneity that is important for an outcome of functional
property. Uniformity does not lead to such an outcome. Behavioral properties
arise from functional properties when proteins with diverse sequences of amino
acids (8 ) interact with each other within a cell, in response to stimuli at the
cell surface in a process called signal
transduction (9). The interactions between diverse proteins mediated by
a specific sequence of amino acids or protein motifs via complementary binding is
the key. At the functional and behavioural level, it is the diversity of the
interacting components that lead to a response to a stimulus, that is key
property of life. Homogeneity or uniformity is unable to achieve this.
Thus, the argument that consciousness emerges
from matter fails at this point since by the above interactions,
homogenous or uniform matter is dead, and varied and heterogenous matter is
alive. How can matter be dead and alive at
the same time ? Infact the only argument left for materialists is
that consciousness emerges from heterogenous matter that interact with each
other. But then the next question that arises what is the boundary between the
living and the dead ? It is like an infinite regress. If consciousness does
indeed arise from matter, then it seems to be very specific types of matter
arranged in highly specific configurations.
On the other hand,
if consciousness is indeed the fundamental substratum of the universe, it can manifest
itself through different degrees in different configurations of matter. In this
scenario even a homopolymer or matter with homogeneity manifests sentience or living properties to an extremely
low extent. For example crystals, which have identical repeating subunits are
capable of replication, which is a living property. Heteropolymers like DNA
manifest the ability to direct the sentience of a cell , as DNA is capable of
directing the formation of proteins, which have functional properties. Protein-protein
interactions, protein-dna interactions result in cell behavior that includes both metabolism and replication
which are both living properties.
I would like to
propose that the role of artificial intelligence would be to use machine
learning algorithms, that have learnt pattern or motif recognition from
naturally occurring biomolecules like DNA and proteins which are essentially heterogenous.
They would then direct the bioprinting of polymers consisting of these motifs (10,11).
These biopolymers would then interact with each other in varied ways.
Interactions would lead to phase transition, leading to the creation of different fluid properties or densities
of the resulting structures, that gradually progresses towards
self-organization. Through the mechanism of phase transition (10), the artificial
intelligence directed 3D-bioprinted agents, acquire more complex structures, functions
and behavioral properties.
What is meant
by increasing complexity?
A salt crystal
is formed by repeating units of sodium and chlorine atoms, to form a regular
lattice. The coat of a virus called an "icosahedron" is made of
repeating units of protein, with the smallest shape being a triangle which
arranges itself with increasing complexity in terms of numbers (12). Bacteria
have repeating units of coat protein surrounded by a lipid envelope. As one
moves to yeast, there are fission yeasts (yeasts that split) and budding
yeasts. Suddenly "things start to look different". There are
fungi-zygomycetes that form round spores, ascomycetous fungi where spores are
enclosed in a sac-like structure and basidiomycetous fungi where spores are
arranged on club shaped structures (12).
Then we move to
the plant kingdom, where the common factor is photosynthesis-but plants look
different. Can one visually compare a weed, shrub, herb or a creeper? Things
get more interesting in the animal kingdom where each species looks different
from the other. But with more complex forms, there is more complex regulation
and greater variety of functions: for example, it is no longer about eating to
reproduce and survive, but there are more complex inter-species interactions
for mutual benefits, or antagonistic relationships such as that of a prey and a
predator, or a combination of both, for example commensalism. With increasing
complexity of a species, interactions between species become more important
giving rise to food chains and food webs (13).
The final
outcome: Predicting the evolution of life-forms
The prediction
is that 3D bio-printed agents directed by Artificial Intelligence involving
Machine Learning Algorithms, will show greater manifestation of Consciousness
with increasing complexity. This will occur only if Consciousness/Awareness is
the underlying substratum or field of the Universe. With greater manifestation
of conscious agents there will be more interactions of the 3D bioprinted
agents, from which will emerge the sculpting of local ecosystems as we humans along
with our related species have sculpted the planet earth. So, the cycle of
manifestation and interactions continues.
I end with the
following verse from the Upanisads (6):
Om purnamdah purnamidam,
purnat purnamudacyate
Purnasya
purnamadaya, purnam evavasisyate
The above
is translated as: All manifest (forms
and life-forms which are infinite in number), arise from the unmanifest (consciousness)
which is also infinite. When one takes away the infinite manifest from the
infinite unmanifest, the infinite still remains.
References:
(1)
Srikanthan Ramesh, Akash Deep,
Ali Tamayol, Abishek Kamaraj, Chaitanya Mahajan, Sundararajan
Madihally,Advancing 3D bioprinting through machine learning and artificial
intelligence,Bioprinting,Volume38,2024,e00331,https://doi.org/10.1016/j.bprint.2024.e00331.
(2)
Murphy SV, Atala A. 3D
bioprinting of tissues and organs. Nat Biotechnol. 2014 Aug;32(8):773-85. doi:
10.1038/nbt.2958. PMID: 25093879.
(3)
Mashour GA, Alkire MT. Evolution of
Consciousness: Phylogeny, Ontogeny, and Emergence from General Anesthesia. In:
National Academy of Sciences; Cela-Conde CJ, Lombardo RG, Avise JC, et al.,
editors. In the Light of Evolution: Volume VII: The Human Mental Machinery.
Washington (DC): National Academies Press (US); 2014 May 19. 3. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK231624/
(4)
The Octopus, the Sea, and the
Deep Origins of Consciousness. Peter Godfrey Smith. Talks at Google. https://www.youtube.com/watch?v=iENXfnOobzw
(5)
Hazen Robert M, Griffin Patrick
L, Carothers James M, et al. Functional Information and the Emergence of
Biocomplexity. In: National Academy of Sciences; Avise JC, Ayala FJ, editors.
In the Light of Evolution: Volume I: Adaptation and Complex Design. Washington
(DC): National Academies Press (US); (2007). 2. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK254300/
(6)
Eight Upanisads: with the
commentary of Sankaracharya (2006 ). 8th impression. Publisher:
Advaita Ashrama
(10)Kotova S,
Kostjuk S, Rochev Y, Efremov Y, Frolova A, Timashev P. Phase transition and
potential biomedical applications of thermoresponsive compositions based on
polysaccharides, proteins and DNA: A review. Int J Biol Macromol. 2023 Sep
30;249:126054. doi: 10.1016/j.ijbiomac.2023.126054. Epub 2023 Jul 31. PMID:
37532189.
(11)Wang X.
Advanced Polymers for Three-Dimensional (3D) Organ Bioprinting. Micromachines
(Basel). 2019 Nov 25;10(12):814. doi: 10.3390/mi10120814. PMID: 31775349;
PMCID: PMC6952999.
(12)Prescott’s
Microbiology. (2020). 11th edition Publisher: Mc Graw Hill Education.
No comments:
Post a Comment