Cancer-A story of condensates, feedback loops and the epigenome ?

 

Cancer_Hypothesis

1.Probably the epigenome of a cell is modified by an oncogenic mutation. Phenotypic plasticity/tumor heterogeneity occurs in this process.

2. This modified epigenome overrides the inhibitory signaling of tumor microenvironment via activating stemness networks. Chaos ensues.

3. The above (2) breaks cell cell interactions leading to tumor cells release from primary site and spread i.e. invasion.

4. Altered epigenome leads to epithelial mesenchymal transition.

5. Tumor cells at secondary site  undergo mesenchymal epithelial transition due to restored epigenome in a new microenvironment.

6. As critical threshold of oncogenic protein/signaling activity is breached (1) happens again.

7. A vicious cycle of tumor growth and spread ensues.

8. Altered expression/phenotype of tumor cells  containing oncogenic mutation occurs via phase transition. Mutant oncogenic proteins form multiple aggregates with their target sustrates forming numerous biomolecular condensates. Sustained oncogenic signaling occurs in biomolecular condensates which are resistant to negative feedback loops.  Membranes of such biomolecular condensates could prevent access of inhibitors to oncogenic signaling. This sustained signaling acts like a siren activating stress response pathways. Such stress response pathways could activate suppressive epigenomic enzymes in a negative feedback loop. The reason being that suppressive epigenomic enzymes such as histone deacetylases can suppress both tumor suppressor and oncogene transcription, but in a tumor it is the tumor suppressor that is silenced, but not the mutant oncogene levels. Ultimately it is cell survival regulating these feedback loops.

9. Since, the unpredictable component is how the epigenome is altered from a normal one to a cancerous one via the  oncogenic mutation,the oncogenic mutation via aberrant signaling could downregulate promoter activity of tumor suppressors via activating suppressive epigenome enzymes  like methylases.  The oncogenic mutation re-inforces its own activity positively since although the promoter of the mutant oncogene can be silenced by methylation, the methyl groups at promoters of mutant oncogenes are removed by demethylases as cell survival is the ultimate goal.

Stemness plays a role when downregulation of a tumor suppressor activates the uncontrolled  self-renewal activity of stemness networks, probably by activating oncogenic transcription factors of stemness networks that function in self-renewal.

The analogy with an Enzymatic Reaction:

Initiator-Oncogenic mutation, Epigenome alteration/Ist hit

Catalyst-Altered Tumor Microenvironment /2nd hit

Telos of the platonic realm-Inspiring the true nature of biology-Life has purpose

 

Telos of the platonic realm-Inspiring the true nature of biology-Life has purpose

 

The Greek word “telos” introduced by Aristotle , the Greek philosopher-biologist, implies purpose or cause.

In Indian philosophy kosha model, describes an outer gross layer-the food or life sheath or Annamayakosha (in Sanskrit, Anna means food), This followed internally by the pranamaya kosha or the life-force sheath, which on further depth reveals the manomaya kosha or the “mind-sheath”. The mind in Sanskrit is the inner instrument denoted as the antahkarana.

In Greek philosophy these inner subtle sheaths of life force and mind should correspond to the platonic realm or the realm of mental phenomenon. 

A key feature of annamayakosha or the life sheath is self-organization. This means the simplest living unit i.e the cell is bounded and separated from the environment by a selectively permeable membrane. This membrane allows only certain nutrients or food constituents to enter the cell, allowing the cell to survive and reproduce as an individual entity. This tendency to survive is so strong that a cancer cell spews out chemotherapeutic drugs or drugs aimed to kill a cancer  cell. I propose that this survival is not merely a Darwinian selection by the environment but an adaptation to varying environmental conditions. The goal of the single cell is to develop into multi-cellular complex species, which include human beings. The pinnacle of achievement of human beings are physical discoveries which drive science and mental discoveries which drive philosophy. Innovation is the application of discovery principles, which entails physical experiments with matter.

In Indian philosophy, primarily denoted in the Upanishad texts, self-realization is the goal of human life. This corresponds to the Greek saying of “Man know thyself”. This knowing is by being (Jnana Yoga) and doings of the mind (Raja Yoga). Knowing this way pre-supposses a mind.

At this juncture , I would like to relive the shloka or verse:

 “Asato Ma Sadgamaya, Tamasoma Jyotir Gamaya, Mrityur Ma Amritam Gamaya”. This literally translates as “May I be led from Untruth to  Truth ( Being), from darkness (ignorance) to light (knowledge) and from death (perishability) to immortality (that which does not perish)

Since the physical perishes, the above shloka is true for our mental universes. The Greek  Telos philosophy comes full circle here, as telos pre-supposes purpose, both the physical and mental have purpose, i.e the purpose of permanence. Since the physical perishes and is impermanent, the Indian philosophy of the Upanishads, says the goal of human life is to know thyself by being and this knowing never dies i.e it is imperishable.

LIFE-FORMS AS MANIFESTATION OF CONSCIOUSNESS

LIFE-FORMS AS  MANIFESTATION OF CONSCIOUSNESS

The Argument: Artificial Intelligence & Bioprinting as tools to test the Universality of Consciousness 

 Artificial Intelligence, which has learned how to assemble biomolecules and/or cell-like structures, using advanced machine learning algorithms, can instruct a 3D Bioprinter with an input of material  constituents like nucleotides, amino acids,  lipids, and in theory build cell-like machines (1). Combinations of cell-like machines with vasculature (fluids like blood encased in polymers) can give rise to 3D bioprinted tissue-like systems (2).

 

The dominant paradigm regarding consciousness in science today, is that “consciousness emerges from matter” (3,4). If that is the case, the question then arises is that why do life-forms with greater diversity (specifically in their  constituents), such as fishes or animals manifest greater functional capabilities (4,5) which is their evidence for being conscious in comparison to simpler forms like crystals with identical repeating units.

 

In contrast to the above, in the  Indian Philosophy of the Upanisads, it  has been stated that  Consciousness (Awareness) is Fundamental & Universal (6). I propose that if awareness, which I define as including sentience (“possessing living properties”) is fundamental and universal, then it will manifest itself to a greater degree, with increasing complexity of artificial intelligence directed 3D-bioprinted  agents that  express  enhanced functional capabilities. The reasoning for the above argument is as follows: If consciousness emerged from matter, then why is there such a major difference in functional properties of materials that possess simple repeating units and those that have greater diversity in their repeating units ? Consider for example a heteropolymer like DNA which has 4 basic units, i.e the 4 bases adenine (A), thymine(T), guanine(G) and cytosine( C) , (7 ) arranged in different combinations like ATGCTAGTTTCAGTGCAGCAT that can code for proteins like hair proteins, nail proteins and millions of other proteins that have different functional properties. However a homopolymer made of one unit like AAAAAAAAAAAAAAA or TTTTTTTTTTTTTT does not code for proteins with different functional properties. This shows that it is the variation or heterogeneity that is important for an outcome of functional property. Uniformity does not lead to such an outcome. Behavioral properties arise from functional properties when proteins with diverse sequences of amino acids (8 ) interact with each other within a cell, in response to stimuli at the cell surface in  a process called signal transduction (9). The interactions between diverse proteins mediated by a specific sequence of amino acids or protein motifs via complementary binding is the key. At the functional and behavioural level, it is the diversity of the interacting components that lead to a response to a stimulus, that is key property of life. Homogeneity or uniformity is unable to achieve this.

 Thus, the argument that consciousness emerges from matter fails at this point since by the above interactions, homogenous or uniform matter is dead, and varied and heterogenous matter is alive. How can matter be dead and alive at  the same time ? Infact the only argument left for materialists is that consciousness emerges from heterogenous matter that interact with each other. But then the next question that arises what is the boundary between the living and the dead ? It is like an infinite regress. If consciousness does indeed arise from matter, then it seems to be very specific types of matter arranged in highly specific configurations.

On the other hand, if consciousness is indeed the fundamental substratum of the universe, it can manifest itself through different degrees in different configurations of matter. In this scenario even a homopolymer or matter with homogeneity manifests  sentience or living properties to an extremely low extent. For example crystals, which have identical repeating subunits are capable of replication, which is a living property. Heteropolymers like DNA manifest the ability to direct the sentience of a cell , as DNA is capable of directing the formation of proteins, which have functional properties. Protein-protein interactions, protein-dna interactions result in cell behavior  that includes both metabolism and replication which are both living properties.   

I would like to propose that the role of artificial intelligence would be to use machine learning algorithms, that have learnt pattern or motif recognition from naturally occurring biomolecules like DNA and proteins which are essentially heterogenous. They would then direct the bioprinting of polymers consisting of these motifs (10,11). These biopolymers would then interact with each other in varied ways. Interactions would lead to phase transition, leading to  the creation of different fluid properties or densities of the resulting structures, that gradually progresses towards self-organization. Through the mechanism of phase transition (10), the artificial intelligence directed 3D-bioprinted agents, acquire more complex structures, functions and behavioral properties.

 

What is meant by increasing complexity? 

A salt crystal is formed by repeating units of sodium and chlorine atoms, to form a regular lattice. The coat of a virus called an "icosahedron" is made of repeating units of protein, with the smallest shape being a triangle which arranges itself with increasing complexity in terms of numbers (12). Bacteria have repeating units of coat protein surrounded by a lipid envelope. As one moves to yeast, there are fission yeasts (yeasts that split) and budding yeasts. Suddenly "things start to look different". There are fungi-zygomycetes that form round spores, ascomycetous fungi where spores are enclosed in a sac-like structure and basidiomycetous fungi where spores are arranged on club shaped structures (12).

Then we move to the plant kingdom, where the common factor is photosynthesis-but plants look different. Can one visually compare a weed, shrub, herb or a creeper? Things get more interesting in the animal kingdom where each species looks different from the other. But with more complex forms, there is more complex regulation and greater variety of functions: for example, it is no longer about eating to reproduce and survive, but there are more complex inter-species interactions for mutual benefits, or antagonistic relationships such as that of a prey and a predator, or a combination of both, for example commensalism. With increasing complexity of a species, interactions between species become more important giving rise to food chains and food webs (13). 

 

The final outcome: Predicting the evolution of life-forms

The prediction is that 3D bio-printed agents directed by Artificial Intelligence involving Machine Learning Algorithms, will show greater manifestation of Consciousness with increasing complexity. This will occur only if Consciousness/Awareness is the underlying substratum or field of the Universe. With greater manifestation of conscious agents there will be more interactions of the 3D bioprinted agents, from which will emerge the sculpting of local ecosystems as we humans along with our related species have sculpted the planet earth. So, the cycle of manifestation and interactions continues. 

I end with the following verse from the Upanisads (6):

Om purnamdah purnamidam, purnat purnamudacyate

Purnasya purnamadaya, purnam evavasisyate

 The above is translated as:  All manifest (forms and life-forms which are infinite in number), arise from the unmanifest (consciousness) which is also infinite. When one takes away the infinite manifest from the infinite unmanifest, the infinite still remains.

References:

(1)    Srikanthan Ramesh, Akash Deep, Ali Tamayol, Abishek Kamaraj, Chaitanya Mahajan, Sundararajan Madihally,Advancing 3D bioprinting through machine learning and artificial intelligence,Bioprinting,Volume38,2024,e00331,https://doi.org/10.1016/j.bprint.2024.e00331.

(2)    Murphy SV, Atala A. 3D bioprinting of tissues and organs. Nat Biotechnol. 2014 Aug;32(8):773-85. doi: 10.1038/nbt.2958. PMID: 25093879.

(3)     Mashour GA, Alkire MT. Evolution of Consciousness: Phylogeny, Ontogeny, and Emergence from General Anesthesia. In: National Academy of Sciences; Cela-Conde CJ, Lombardo RG, Avise JC, et al., editors. In the Light of Evolution: Volume VII: The Human Mental Machinery. Washington (DC): National Academies Press (US); 2014 May 19. 3. Available from: https://www.ncbi.nlm.nih.gov/books/NBK231624/

(4)    The Octopus, the Sea, and the Deep Origins of Consciousness. Peter Godfrey Smith. Talks at Google.  https://www.youtube.com/watch?v=iENXfnOobzw

(5)    Hazen Robert M, Griffin Patrick L, Carothers James M, et al. Functional Information and the Emergence of Biocomplexity. In: National Academy of Sciences; Avise JC, Ayala FJ, editors. In the Light of Evolution: Volume I: Adaptation and Complex Design. Washington (DC): National Academies Press (US); (2007). 2. Available from: https://www.ncbi.nlm.nih.gov/books/NBK254300/

(6)    Eight Upanisads: with the commentary of Sankaracharya (2006 ). 8^th impression. Publisher: Advaita Ashrama

(7)    https://bio.libretexts.org/Bookshelves/Introductory_and_General_Biology/Concepts_in_Biology_(OpenStax)/09%3A_Molecular_Biology/9.01%3A_The_Structure_of_DNA

(8)    https://bio.libretexts.org/Bookshelves/Biochemistry/Fundamentals_of_Biochemistry_(Jakubowski_and_Flatt)/01%3A_Unit_I-_Structure_and_Catalysis/03%3A_Amino_Acids_Peptides_and_Proteins/3.2%3A_The_Structure_of_Proteins-_An_Overview

(9)    https://bio.libretexts.org/Bookshelves/Cell_and_Molecular_Biology/Book%3A_Cells_-_Molecules_and_Mechanisms_(Wong)/14%3A_Signal_Transduction

 

(10)Kotova S, Kostjuk S, Rochev Y, Efremov Y, Frolova A, Timashev P. Phase transition and potential biomedical applications of thermoresponsive compositions based on polysaccharides, proteins and DNA: A review. Int J Biol Macromol. 2023 Sep 30;249:126054. doi: 10.1016/j.ijbiomac.2023.126054. Epub 2023 Jul 31. PMID: 37532189.

(11)Wang X. Advanced Polymers for Three-Dimensional (3D) Organ Bioprinting. Micromachines (Basel). 2019 Nov 25;10(12):814. doi: 10.3390/mi10120814. PMID: 31775349; PMCID: PMC6952999.

(12)Prescott’s Microbiology. (2020). 11^th edition Publisher: Mc Graw Hill Education.

(13)https://bio.libretexts.org/Courses/Coastline_College/ENVS_C100%3A_Environmental_Science_(Hoerer)/03%3A_Ecology/3.03%3A_Communities/3.3.01%3A_Biotic_Interactions/3.3.1.01%3A_Trophic_Interactions/3.3.1.1.04%3A_Food_Chains_and_Food_Webs

 

 

 

 

 

My Association with HIV Reverse Transcriptase

 My Association with HIV Reverse Transcriptase:

Just saw on linkedin: Dr. David Baltimore, Nobel prize winner  & co-discoverer of HIV-1 Reverse Transcriptase, passes away at 87.

The central dogma of molecular biology involves DNA-the molecule which contains genes, that is    transcribed into RNA, which is eventually made into protein. However an enzyme (proteins that speed up or catalyze reactions within cells) in human immunodeficiency virus (HIV) reverse transcribed RNA into DNA. This went against the central dogma of molecular biology. Researchers Howard Temin & David Baltimore were awarded the Nobel prize for this discovery (1975) , https://www.nobelprize.org/prizes/medicine/1975/baltimore/facts/  

My tryst with HIV Reverse Transcriptase began  in 1999, when I joined Prof. Monica Roth's Laboratory as a graduate research fellow, post a successful laboratory rotation. This was in the Molecular Biosciences program jointly hosted by Rutgers-UMDNJ, New Jersey USA. I picked a project which involved HIV-1 Reverse Transcriptase. It was a protein modeling project.

HIV-1 Reverse Transcriptase has two functional domains: a polymerase which makes the double stranded DNA polymer and an Rnase H domain which breaks down the RNA component (derived from HIV and also the tRNA primer) of the RNA-DNA hybrids, so as to form a full double stranded DNA genome ,that can integrate into the host cell DNA and remain as a provirus. Prof. Roth had designed a polypeptide minus the polymerase domain, so as to  screen for inhibitors of HIV-1 RNaseH enzyme only.

It took 6 months to clone the polypeptide. This was followed by purification  and testing activity of this polypeptide on hybrid RNA-DNA substrates, in the presence of manganese, which took two and a half years. These findings culminated in a paper in 2004, and the design made to the cover of the  journal: Protein Engineering Design & Selection (PEDS):

https://academic.oup.com/peds/article-abstract/17/7/581/1553405

This designed polypeptide formed the precursor to an RnaseH  polypeptide that functioned in the physiological cation, Magnesium, and a subsequent paper from Prof. Roths laboratory.

Interestingly , when I co-wrote a book chapter , on DNA viruses containing reverse transcriptases;

https://www.taylorfrancis.com/chapters/edit/10.1201/9781003369349-15/dna-viruses-containing-reverse-transcriptase-sonali-sengupta-baibaswata-nayak ,we included the Baltimore classification of viruses.

So Prof. David Baltimore has indirectly played an invaluable role in catalysing my growth as a researcher , and this blogpost is in memory of this great scientist. I bow to him with humility.

AI & 3D bioprinting

 A combination of Artificial Intelligence (which has learned how to assemble an artificial cell) that  gives instructions to the 3D Bioprinter with an input of  cellular constituents, can in theory build cellular machines.

Combinations of cells with vasculature can give rise to 3D bioprinted tissues,organs, organ systems & eventually organisms.

If Consciousness (Awareness) is Fundamental & Universal then it will express itself to a greater degree manifesting enhanced capabilities with increasing complexity of 3D- bioprinted  agents.

What do I mean by increasing complexity? 

A salt crystal is formed by repeating units of sodium and chlorine atoms to form a regular lattice. The coat of a virus called an "icosahedron" is made of repeating units of protein, with the smallest shape being a triangle which arranges itself with increasing complexity in terms of numbers. Bacteria have repeating units of coat protein surrounded by a lipid envelope. As one moves to yeast, there are fission yeasts (yeasts that split) and budding yeasts. Suddenly "things start to look different". There are fungi-zygomycetes that form round spores, ascomycetous fungi where spores are enclosed in a sac like structure and basidiomycetous fungi where spores are arranged on club shaped structures.

Then we move to the plant kingdom, where the common factor is photosynthesis-but plants look different. Can you really visually compare a weed, shrub, herb or a creeper ? Things get more interesting in the animal kingdom where each species looks different from the other. But with more complex forms, there is more complex regulation and greater variety of functions for example it is no more about eating to reproduce and survive, but there are more complex inter-species interactions for mutual benefits, or antagonistic relationships such as that of a prey and a predator, or a combination of both , for example commensalism. So with increasing complexity of a species, interactions between species become more important giving rise to food chains and food webs. 

The prediction is that 3D bio-printed agents directed by Artificial Intelligence involving Machine Learning Algorithms, will show greater manifestation of Consciousness with increasing complexity, if Consciousness/Awareness is the underlying substratum/field of the Universe. With greater manifestation of conscious agents there will be more interactions of the 3D bioprinted agents, from which will emerge the sculpting of local ecosystems as we humans aong with our related species have sculpted the planet earth. So, the cycle of manifestation and interactions continues. 

I end with the following:

   

 All manifest forms and life-forms which are infinite, arise from the unmanifest which is also infinite. When one takes away the infinite manifest from the infinite unmanifest, the infinite still remains.

                   II SHANTIH II 

Cancer Vaccine-ADJUVANT THERAPY

 Assumption 

The theoretical assumption is that,   neo-antigens in tumor cells are probably oncogenes which may be poorly presented on the cell surface. This could be due to low expression levels, or inappropriate interaction of cell-surface neo-antigens, with MHC II molecules, more specifically the  inhibitory peptide. This inhibitory peptide, could form unstable complexes with the neo-antigen and MHC II, resulting in failed neoantigen-presentation. Thus the tumor survivesthe   immunosurveillance process.

The tumor suppressor polypeptide (based on the amino acid sequence) could fold in such a way that it forms stable complexes with MHC II, that is not inhibited by the inhibitory peptide. This leads to proper antigen-presentation. In this instance, the tumor is targeted by the immune system (cell-defense mechanism) and gets eliminated.

A successful cancer vaccine would override the above biology, for example an adjuvant such as an emulsion, could cloak the inhibitory peptide in the case of a neo-antigen/oncogenic polypeptide resulting in stable complexes, that leads to successful antigen-presentation, and elimination of the tumor.

Therapy/Cure ensues.      

Cellular_Metastasis

THEORY Of METASTASIS  : (Metastatic Cancer is the NEMESIS) 

Tumorigenesis :

During tumor initiation, cells intially divide, to form a cluster of cells. This cell division, is based on the evolutionary theory of Darwin, i.e. natural selection.

Tumor cell circulation :

 These cluster of cells, circulate through blood in inhospitable environments, to newer sites. At the newer sites, they secrete tumor-suppressive molecules which block inhibitory factors, that prevent the seeding of cancer seed cells in newer environments. This leads to the hypothesis that the transcriptional machinery (involving RNA and transcriptional factors),  adsorbed by the promoters of tumor-suppressors. The assumption is that, the quantitative relation between oncogenes and tumor-suppressors is an inverse one. 

Metastasis :

With excessive levels of tumor suppressors, a negative feedback loop functions to prevent apoptosis (programmed cell death), of cells  in-order that cell survival ensues. This leads to the increase in levels of oncogenes to counteract the excessive levels of tumor-suppressors,that could be termed as ADAPTATION (Jean-Baptiste Lamarck; French Natural Philosopher); further increase in oncogenic levels/activity ensues, leading to cell division and and metastatic tumors at secondary sites. 

Nomenclature (Terminology)

This progress of events could be termed Dar-Lam-Da or alternatively Darwinian survival-Lamarckian Adaptation followed by Darwinian survival.          

 

(Lyrics):

https://www.youtube.com/watch?v=S4kzGhDEURA